ID: 948767692

View in Genome Browser
Species Human (GRCh38)
Location 2:240231979-240232001
Sequence GAGTCGGCTTTGTTGGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948767676_948767692 27 Left 948767676 2:240231929-240231951 CCAAAACAGACCAACAGTACCAC No data
Right 948767692 2:240231979-240232001 GAGTCGGCTTTGTTGGGGCCAGG No data
948767680_948767692 17 Left 948767680 2:240231939-240231961 CCAACAGTACCACCCTGGAGGGA No data
Right 948767692 2:240231979-240232001 GAGTCGGCTTTGTTGGGGCCAGG No data
948767683_948767692 4 Left 948767683 2:240231952-240231974 CCTGGAGGGACTCATCTGTCTCC No data
Right 948767692 2:240231979-240232001 GAGTCGGCTTTGTTGGGGCCAGG No data
948767681_948767692 8 Left 948767681 2:240231948-240231970 CCACCCTGGAGGGACTCATCTGT No data
Right 948767692 2:240231979-240232001 GAGTCGGCTTTGTTGGGGCCAGG No data
948767682_948767692 5 Left 948767682 2:240231951-240231973 CCCTGGAGGGACTCATCTGTCTC No data
Right 948767692 2:240231979-240232001 GAGTCGGCTTTGTTGGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948767692 Original CRISPR GAGTCGGCTTTGTTGGGGCC AGG Intergenic