ID: 948768148

View in Genome Browser
Species Human (GRCh38)
Location 2:240233798-240233820
Sequence CTGTGGGCAGGGCCGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948768148_948768165 21 Left 948768148 2:240233798-240233820 CCCTCCTCCGGCCCTGCCCACAG No data
Right 948768165 2:240233842-240233864 TCCACAGTGCCTCTTTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948768148 Original CRISPR CTGTGGGCAGGGCCGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr