ID: 948768683

View in Genome Browser
Species Human (GRCh38)
Location 2:240236365-240236387
Sequence AGGTGCAAACAGGAGGACGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948768683_948768686 -10 Left 948768683 2:240236365-240236387 CCATCGTCCTCCTGTTTGCACCT No data
Right 948768686 2:240236378-240236400 GTTTGCACCTCTGCTCCTCCTGG No data
948768683_948768687 -9 Left 948768683 2:240236365-240236387 CCATCGTCCTCCTGTTTGCACCT No data
Right 948768687 2:240236379-240236401 TTTGCACCTCTGCTCCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948768683 Original CRISPR AGGTGCAAACAGGAGGACGA TGG (reversed) Intergenic
No off target data available for this crispr