ID: 948770449

View in Genome Browser
Species Human (GRCh38)
Location 2:240248953-240248975
Sequence AGGTGAGTATGGGGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948770437_948770449 1 Left 948770437 2:240248929-240248951 CCTGAGGGAGGTACCATTATCCC No data
Right 948770449 2:240248953-240248975 AGGTGAGTATGGGGGGCAGAGGG No data
948770435_948770449 6 Left 948770435 2:240248924-240248946 CCAGCCCTGAGGGAGGTACCATT No data
Right 948770449 2:240248953-240248975 AGGTGAGTATGGGGGGCAGAGGG No data
948770431_948770449 23 Left 948770431 2:240248907-240248929 CCAGTTCATCTTCAACACCAGCC No data
Right 948770449 2:240248953-240248975 AGGTGAGTATGGGGGGCAGAGGG No data
948770436_948770449 2 Left 948770436 2:240248928-240248950 CCCTGAGGGAGGTACCATTATCC No data
Right 948770449 2:240248953-240248975 AGGTGAGTATGGGGGGCAGAGGG No data
948770430_948770449 24 Left 948770430 2:240248906-240248928 CCCAGTTCATCTTCAACACCAGC No data
Right 948770449 2:240248953-240248975 AGGTGAGTATGGGGGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948770449 Original CRISPR AGGTGAGTATGGGGGGCAGA GGG Intergenic
No off target data available for this crispr