ID: 948770944

View in Genome Browser
Species Human (GRCh38)
Location 2:240251007-240251029
Sequence GTGCCCACCCTTTCTTCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948770944_948770960 22 Left 948770944 2:240251007-240251029 CCCTGAGAAGAAAGGGTGGGCAC No data
Right 948770960 2:240251052-240251074 AAGGGCATGAGGAGAGGGCCCGG No data
948770944_948770947 3 Left 948770944 2:240251007-240251029 CCCTGAGAAGAAAGGGTGGGCAC No data
Right 948770947 2:240251033-240251055 CCCTCCGCCCCCACCCATAAAGG No data
948770944_948770957 16 Left 948770944 2:240251007-240251029 CCCTGAGAAGAAAGGGTGGGCAC No data
Right 948770957 2:240251046-240251068 CCCATAAAGGGCATGAGGAGAGG No data
948770944_948770949 4 Left 948770944 2:240251007-240251029 CCCTGAGAAGAAAGGGTGGGCAC No data
Right 948770949 2:240251034-240251056 CCTCCGCCCCCACCCATAAAGGG No data
948770944_948770953 11 Left 948770944 2:240251007-240251029 CCCTGAGAAGAAAGGGTGGGCAC No data
Right 948770953 2:240251041-240251063 CCCCACCCATAAAGGGCATGAGG No data
948770944_948770959 17 Left 948770944 2:240251007-240251029 CCCTGAGAAGAAAGGGTGGGCAC No data
Right 948770959 2:240251047-240251069 CCATAAAGGGCATGAGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948770944 Original CRISPR GTGCCCACCCTTTCTTCTCA GGG (reversed) Intergenic
No off target data available for this crispr