ID: 948771045

View in Genome Browser
Species Human (GRCh38)
Location 2:240251407-240251429
Sequence CCCTCATCCCACACAGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948771033_948771045 19 Left 948771033 2:240251365-240251387 CCCGTGGCCTCACAGAGCAGCCT No data
Right 948771045 2:240251407-240251429 CCCTCATCCCACACAGAAGGAGG No data
948771036_948771045 12 Left 948771036 2:240251372-240251394 CCTCACAGAGCAGCCTCAGAGGC No data
Right 948771045 2:240251407-240251429 CCCTCATCCCACACAGAAGGAGG No data
948771038_948771045 -10 Left 948771038 2:240251394-240251416 CCAGCCTGCCACCCCCTCATCCC No data
Right 948771045 2:240251407-240251429 CCCTCATCCCACACAGAAGGAGG No data
948771031_948771045 21 Left 948771031 2:240251363-240251385 CCCCCGTGGCCTCACAGAGCAGC No data
Right 948771045 2:240251407-240251429 CCCTCATCCCACACAGAAGGAGG No data
948771034_948771045 18 Left 948771034 2:240251366-240251388 CCGTGGCCTCACAGAGCAGCCTC No data
Right 948771045 2:240251407-240251429 CCCTCATCCCACACAGAAGGAGG No data
948771037_948771045 -1 Left 948771037 2:240251385-240251407 CCTCAGAGGCCAGCCTGCCACCC No data
Right 948771045 2:240251407-240251429 CCCTCATCCCACACAGAAGGAGG No data
948771032_948771045 20 Left 948771032 2:240251364-240251386 CCCCGTGGCCTCACAGAGCAGCC No data
Right 948771045 2:240251407-240251429 CCCTCATCCCACACAGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948771045 Original CRISPR CCCTCATCCCACACAGAAGG AGG Intergenic
No off target data available for this crispr