ID: 948771299

View in Genome Browser
Species Human (GRCh38)
Location 2:240252535-240252557
Sequence CTGTGAACACGGAGCTGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948771299_948771304 8 Left 948771299 2:240252535-240252557 CCGCGGCAGCTCCGTGTTCACAG No data
Right 948771304 2:240252566-240252588 ACACAGAAATGACTGTGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948771299 Original CRISPR CTGTGAACACGGAGCTGCCG CGG (reversed) Intergenic
No off target data available for this crispr