ID: 948771329

View in Genome Browser
Species Human (GRCh38)
Location 2:240252663-240252685
Sequence TGGCCGCCACCCACCCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948771329_948771338 10 Left 948771329 2:240252663-240252685 CCCAGCTGGGTGGGTGGCGGCCA No data
Right 948771338 2:240252696-240252718 AGTGAGTGTGAGGGTGCCTGGGG No data
948771329_948771344 28 Left 948771329 2:240252663-240252685 CCCAGCTGGGTGGGTGGCGGCCA No data
Right 948771344 2:240252714-240252736 TGGGGATGGAGACGGTGCCGGGG No data
948771329_948771339 14 Left 948771329 2:240252663-240252685 CCCAGCTGGGTGGGTGGCGGCCA No data
Right 948771339 2:240252700-240252722 AGTGTGAGGGTGCCTGGGGATGG No data
948771329_948771335 1 Left 948771329 2:240252663-240252685 CCCAGCTGGGTGGGTGGCGGCCA No data
Right 948771335 2:240252687-240252709 GCAGCTGGGAGTGAGTGTGAGGG No data
948771329_948771337 9 Left 948771329 2:240252663-240252685 CCCAGCTGGGTGGGTGGCGGCCA No data
Right 948771337 2:240252695-240252717 GAGTGAGTGTGAGGGTGCCTGGG No data
948771329_948771340 20 Left 948771329 2:240252663-240252685 CCCAGCTGGGTGGGTGGCGGCCA No data
Right 948771340 2:240252706-240252728 AGGGTGCCTGGGGATGGAGACGG No data
948771329_948771343 27 Left 948771329 2:240252663-240252685 CCCAGCTGGGTGGGTGGCGGCCA No data
Right 948771343 2:240252713-240252735 CTGGGGATGGAGACGGTGCCGGG No data
948771329_948771342 26 Left 948771329 2:240252663-240252685 CCCAGCTGGGTGGGTGGCGGCCA No data
Right 948771342 2:240252712-240252734 CCTGGGGATGGAGACGGTGCCGG No data
948771329_948771336 8 Left 948771329 2:240252663-240252685 CCCAGCTGGGTGGGTGGCGGCCA No data
Right 948771336 2:240252694-240252716 GGAGTGAGTGTGAGGGTGCCTGG No data
948771329_948771334 0 Left 948771329 2:240252663-240252685 CCCAGCTGGGTGGGTGGCGGCCA No data
Right 948771334 2:240252686-240252708 TGCAGCTGGGAGTGAGTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948771329 Original CRISPR TGGCCGCCACCCACCCAGCT GGG (reversed) Intergenic
No off target data available for this crispr