ID: 948772702

View in Genome Browser
Species Human (GRCh38)
Location 2:240259647-240259669
Sequence GGCTGCGAAAAACTTCCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948772702_948772707 21 Left 948772702 2:240259647-240259669 CCCATGGGAAGTTTTTCGCAGCC No data
Right 948772707 2:240259691-240259713 GTGCAACGTCACCTACTCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948772702 Original CRISPR GGCTGCGAAAAACTTCCCAT GGG (reversed) Intergenic
No off target data available for this crispr