ID: 948777867

View in Genome Browser
Species Human (GRCh38)
Location 2:240299239-240299261
Sequence CAGGCTGAGGAGCCCGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948777867_948777883 23 Left 948777867 2:240299239-240299261 CCTCCTCCGGGCTCCTCAGCCTG No data
Right 948777883 2:240299285-240299307 GCAAGGCATGGTGCTACAGGGGG No data
948777867_948777876 1 Left 948777867 2:240299239-240299261 CCTCCTCCGGGCTCCTCAGCCTG No data
Right 948777876 2:240299263-240299285 CTGGATGCTGATGAGGGCCTTGG No data
948777867_948777877 6 Left 948777867 2:240299239-240299261 CCTCCTCCGGGCTCCTCAGCCTG No data
Right 948777877 2:240299268-240299290 TGCTGATGAGGGCCTTGGCAAGG No data
948777867_948777872 -6 Left 948777867 2:240299239-240299261 CCTCCTCCGGGCTCCTCAGCCTG No data
Right 948777872 2:240299256-240299278 AGCCTGCCTGGATGCTGATGAGG No data
948777867_948777873 -5 Left 948777867 2:240299239-240299261 CCTCCTCCGGGCTCCTCAGCCTG No data
Right 948777873 2:240299257-240299279 GCCTGCCTGGATGCTGATGAGGG No data
948777867_948777882 22 Left 948777867 2:240299239-240299261 CCTCCTCCGGGCTCCTCAGCCTG No data
Right 948777882 2:240299284-240299306 GGCAAGGCATGGTGCTACAGGGG No data
948777867_948777880 20 Left 948777867 2:240299239-240299261 CCTCCTCCGGGCTCCTCAGCCTG No data
Right 948777880 2:240299282-240299304 TTGGCAAGGCATGGTGCTACAGG No data
948777867_948777878 11 Left 948777867 2:240299239-240299261 CCTCCTCCGGGCTCCTCAGCCTG No data
Right 948777878 2:240299273-240299295 ATGAGGGCCTTGGCAAGGCATGG No data
948777867_948777881 21 Left 948777867 2:240299239-240299261 CCTCCTCCGGGCTCCTCAGCCTG No data
Right 948777881 2:240299283-240299305 TGGCAAGGCATGGTGCTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948777867 Original CRISPR CAGGCTGAGGAGCCCGGAGG AGG (reversed) Intergenic
No off target data available for this crispr