ID: 948777876

View in Genome Browser
Species Human (GRCh38)
Location 2:240299263-240299285
Sequence CTGGATGCTGATGAGGGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948777865_948777876 8 Left 948777865 2:240299232-240299254 CCCTTGGCCTCCTCCGGGCTCCT No data
Right 948777876 2:240299263-240299285 CTGGATGCTGATGAGGGCCTTGG No data
948777861_948777876 19 Left 948777861 2:240299221-240299243 CCACACCTCTGCCCTTGGCCTCC No data
Right 948777876 2:240299263-240299285 CTGGATGCTGATGAGGGCCTTGG No data
948777858_948777876 27 Left 948777858 2:240299213-240299235 CCTCCTGGCCACACCTCTGCCCT No data
Right 948777876 2:240299263-240299285 CTGGATGCTGATGAGGGCCTTGG No data
948777862_948777876 14 Left 948777862 2:240299226-240299248 CCTCTGCCCTTGGCCTCCTCCGG No data
Right 948777876 2:240299263-240299285 CTGGATGCTGATGAGGGCCTTGG No data
948777868_948777876 -2 Left 948777868 2:240299242-240299264 CCTCCGGGCTCCTCAGCCTGCCT No data
Right 948777876 2:240299263-240299285 CTGGATGCTGATGAGGGCCTTGG No data
948777866_948777876 7 Left 948777866 2:240299233-240299255 CCTTGGCCTCCTCCGGGCTCCTC No data
Right 948777876 2:240299263-240299285 CTGGATGCTGATGAGGGCCTTGG No data
948777870_948777876 -5 Left 948777870 2:240299245-240299267 CCGGGCTCCTCAGCCTGCCTGGA No data
Right 948777876 2:240299263-240299285 CTGGATGCTGATGAGGGCCTTGG No data
948777867_948777876 1 Left 948777867 2:240299239-240299261 CCTCCTCCGGGCTCCTCAGCCTG No data
Right 948777876 2:240299263-240299285 CTGGATGCTGATGAGGGCCTTGG No data
948777859_948777876 24 Left 948777859 2:240299216-240299238 CCTGGCCACACCTCTGCCCTTGG No data
Right 948777876 2:240299263-240299285 CTGGATGCTGATGAGGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948777876 Original CRISPR CTGGATGCTGATGAGGGCCT TGG Intergenic
No off target data available for this crispr