ID: 948777878

View in Genome Browser
Species Human (GRCh38)
Location 2:240299273-240299295
Sequence ATGAGGGCCTTGGCAAGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948777871_948777878 -2 Left 948777871 2:240299252-240299274 CCTCAGCCTGCCTGGATGCTGAT No data
Right 948777878 2:240299273-240299295 ATGAGGGCCTTGGCAAGGCATGG No data
948777866_948777878 17 Left 948777866 2:240299233-240299255 CCTTGGCCTCCTCCGGGCTCCTC No data
Right 948777878 2:240299273-240299295 ATGAGGGCCTTGGCAAGGCATGG No data
948777862_948777878 24 Left 948777862 2:240299226-240299248 CCTCTGCCCTTGGCCTCCTCCGG No data
Right 948777878 2:240299273-240299295 ATGAGGGCCTTGGCAAGGCATGG No data
948777865_948777878 18 Left 948777865 2:240299232-240299254 CCCTTGGCCTCCTCCGGGCTCCT No data
Right 948777878 2:240299273-240299295 ATGAGGGCCTTGGCAAGGCATGG No data
948777870_948777878 5 Left 948777870 2:240299245-240299267 CCGGGCTCCTCAGCCTGCCTGGA No data
Right 948777878 2:240299273-240299295 ATGAGGGCCTTGGCAAGGCATGG No data
948777868_948777878 8 Left 948777868 2:240299242-240299264 CCTCCGGGCTCCTCAGCCTGCCT No data
Right 948777878 2:240299273-240299295 ATGAGGGCCTTGGCAAGGCATGG No data
948777861_948777878 29 Left 948777861 2:240299221-240299243 CCACACCTCTGCCCTTGGCCTCC No data
Right 948777878 2:240299273-240299295 ATGAGGGCCTTGGCAAGGCATGG No data
948777874_948777878 -8 Left 948777874 2:240299258-240299280 CCTGCCTGGATGCTGATGAGGGC No data
Right 948777878 2:240299273-240299295 ATGAGGGCCTTGGCAAGGCATGG No data
948777867_948777878 11 Left 948777867 2:240299239-240299261 CCTCCTCCGGGCTCCTCAGCCTG No data
Right 948777878 2:240299273-240299295 ATGAGGGCCTTGGCAAGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948777878 Original CRISPR ATGAGGGCCTTGGCAAGGCA TGG Intergenic
No off target data available for this crispr