ID: 948777881

View in Genome Browser
Species Human (GRCh38)
Location 2:240299283-240299305
Sequence TGGCAAGGCATGGTGCTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948777874_948777881 2 Left 948777874 2:240299258-240299280 CCTGCCTGGATGCTGATGAGGGC No data
Right 948777881 2:240299283-240299305 TGGCAAGGCATGGTGCTACAGGG No data
948777867_948777881 21 Left 948777867 2:240299239-240299261 CCTCCTCCGGGCTCCTCAGCCTG No data
Right 948777881 2:240299283-240299305 TGGCAAGGCATGGTGCTACAGGG No data
948777865_948777881 28 Left 948777865 2:240299232-240299254 CCCTTGGCCTCCTCCGGGCTCCT No data
Right 948777881 2:240299283-240299305 TGGCAAGGCATGGTGCTACAGGG No data
948777868_948777881 18 Left 948777868 2:240299242-240299264 CCTCCGGGCTCCTCAGCCTGCCT No data
Right 948777881 2:240299283-240299305 TGGCAAGGCATGGTGCTACAGGG No data
948777870_948777881 15 Left 948777870 2:240299245-240299267 CCGGGCTCCTCAGCCTGCCTGGA No data
Right 948777881 2:240299283-240299305 TGGCAAGGCATGGTGCTACAGGG No data
948777875_948777881 -2 Left 948777875 2:240299262-240299284 CCTGGATGCTGATGAGGGCCTTG No data
Right 948777881 2:240299283-240299305 TGGCAAGGCATGGTGCTACAGGG No data
948777866_948777881 27 Left 948777866 2:240299233-240299255 CCTTGGCCTCCTCCGGGCTCCTC No data
Right 948777881 2:240299283-240299305 TGGCAAGGCATGGTGCTACAGGG No data
948777871_948777881 8 Left 948777871 2:240299252-240299274 CCTCAGCCTGCCTGGATGCTGAT No data
Right 948777881 2:240299283-240299305 TGGCAAGGCATGGTGCTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948777881 Original CRISPR TGGCAAGGCATGGTGCTACA GGG Intergenic
No off target data available for this crispr