ID: 948778634

View in Genome Browser
Species Human (GRCh38)
Location 2:240303402-240303424
Sequence TATCCCACCCACAGTGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948778634_948778637 -2 Left 948778634 2:240303402-240303424 CCTCTCCCACTGTGGGTGGGATA No data
Right 948778637 2:240303423-240303445 TAGACTCTTTCCTGTCCCATTGG No data
948778634_948778644 28 Left 948778634 2:240303402-240303424 CCTCTCCCACTGTGGGTGGGATA No data
Right 948778644 2:240303453-240303475 TTTGGTCATATGACATCTTTTGG No data
948778634_948778639 5 Left 948778634 2:240303402-240303424 CCTCTCCCACTGTGGGTGGGATA No data
Right 948778639 2:240303430-240303452 TTTCCTGTCCCATTGGTTTTGGG No data
948778634_948778641 10 Left 948778634 2:240303402-240303424 CCTCTCCCACTGTGGGTGGGATA No data
Right 948778641 2:240303435-240303457 TGTCCCATTGGTTTTGGGTTTGG No data
948778634_948778638 4 Left 948778634 2:240303402-240303424 CCTCTCCCACTGTGGGTGGGATA No data
Right 948778638 2:240303429-240303451 CTTTCCTGTCCCATTGGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948778634 Original CRISPR TATCCCACCCACAGTGGGAG AGG (reversed) Intergenic
No off target data available for this crispr