ID: 948778919

View in Genome Browser
Species Human (GRCh38)
Location 2:240305051-240305073
Sequence CAGGCTGGGAGCTGGCGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948778919_948778934 10 Left 948778919 2:240305051-240305073 CCTCCTCGCCAGCTCCCAGCCTG No data
Right 948778934 2:240305084-240305106 TTGATGGGGAGGAGAGCATGTGG No data
948778919_948778939 30 Left 948778919 2:240305051-240305073 CCTCCTCGCCAGCTCCCAGCCTG No data
Right 948778939 2:240305104-240305126 TGGCAGATGAATGGGGGCTCAGG No data
948778919_948778935 21 Left 948778919 2:240305051-240305073 CCTCCTCGCCAGCTCCCAGCCTG No data
Right 948778935 2:240305095-240305117 GAGAGCATGTGGCAGATGAATGG No data
948778919_948778927 -5 Left 948778919 2:240305051-240305073 CCTCCTCGCCAGCTCCCAGCCTG No data
Right 948778927 2:240305069-240305091 GCCTGGGACAGCCCCTTGATGGG No data
948778919_948778930 -1 Left 948778919 2:240305051-240305073 CCTCCTCGCCAGCTCCCAGCCTG No data
Right 948778930 2:240305073-240305095 GGGACAGCCCCTTGATGGGGAGG No data
948778919_948778937 23 Left 948778919 2:240305051-240305073 CCTCCTCGCCAGCTCCCAGCCTG No data
Right 948778937 2:240305097-240305119 GAGCATGTGGCAGATGAATGGGG No data
948778919_948778929 -4 Left 948778919 2:240305051-240305073 CCTCCTCGCCAGCTCCCAGCCTG No data
Right 948778929 2:240305070-240305092 CCTGGGACAGCCCCTTGATGGGG No data
948778919_948778926 -6 Left 948778919 2:240305051-240305073 CCTCCTCGCCAGCTCCCAGCCTG No data
Right 948778926 2:240305068-240305090 AGCCTGGGACAGCCCCTTGATGG No data
948778919_948778938 24 Left 948778919 2:240305051-240305073 CCTCCTCGCCAGCTCCCAGCCTG No data
Right 948778938 2:240305098-240305120 AGCATGTGGCAGATGAATGGGGG No data
948778919_948778936 22 Left 948778919 2:240305051-240305073 CCTCCTCGCCAGCTCCCAGCCTG No data
Right 948778936 2:240305096-240305118 AGAGCATGTGGCAGATGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948778919 Original CRISPR CAGGCTGGGAGCTGGCGAGG AGG (reversed) Intergenic
No off target data available for this crispr