ID: 948781441

View in Genome Browser
Species Human (GRCh38)
Location 2:240324177-240324199
Sequence GCCCGGCCTGGGGCCCCGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948781441_948781458 29 Left 948781441 2:240324177-240324199 CCCTTCGGGGCCCCAGGCCGGGC No data
Right 948781458 2:240324229-240324251 CCTCAAACAGCAGTGGGGCCCGG No data
948781441_948781459 30 Left 948781441 2:240324177-240324199 CCCTTCGGGGCCCCAGGCCGGGC No data
Right 948781459 2:240324230-240324252 CTCAAACAGCAGTGGGGCCCGGG No data
948781441_948781454 23 Left 948781441 2:240324177-240324199 CCCTTCGGGGCCCCAGGCCGGGC No data
Right 948781454 2:240324223-240324245 CACATCCCTCAAACAGCAGTGGG No data
948781441_948781455 24 Left 948781441 2:240324177-240324199 CCCTTCGGGGCCCCAGGCCGGGC No data
Right 948781455 2:240324224-240324246 ACATCCCTCAAACAGCAGTGGGG No data
948781441_948781453 22 Left 948781441 2:240324177-240324199 CCCTTCGGGGCCCCAGGCCGGGC No data
Right 948781453 2:240324222-240324244 CCACATCCCTCAAACAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948781441 Original CRISPR GCCCGGCCTGGGGCCCCGAA GGG (reversed) Intergenic
No off target data available for this crispr