ID: 948781442

View in Genome Browser
Species Human (GRCh38)
Location 2:240324178-240324200
Sequence TGCCCGGCCTGGGGCCCCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948781442_948781453 21 Left 948781442 2:240324178-240324200 CCTTCGGGGCCCCAGGCCGGGCA No data
Right 948781453 2:240324222-240324244 CCACATCCCTCAAACAGCAGTGG No data
948781442_948781458 28 Left 948781442 2:240324178-240324200 CCTTCGGGGCCCCAGGCCGGGCA No data
Right 948781458 2:240324229-240324251 CCTCAAACAGCAGTGGGGCCCGG No data
948781442_948781454 22 Left 948781442 2:240324178-240324200 CCTTCGGGGCCCCAGGCCGGGCA No data
Right 948781454 2:240324223-240324245 CACATCCCTCAAACAGCAGTGGG No data
948781442_948781455 23 Left 948781442 2:240324178-240324200 CCTTCGGGGCCCCAGGCCGGGCA No data
Right 948781455 2:240324224-240324246 ACATCCCTCAAACAGCAGTGGGG No data
948781442_948781459 29 Left 948781442 2:240324178-240324200 CCTTCGGGGCCCCAGGCCGGGCA No data
Right 948781459 2:240324230-240324252 CTCAAACAGCAGTGGGGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948781442 Original CRISPR TGCCCGGCCTGGGGCCCCGA AGG (reversed) Intergenic
No off target data available for this crispr