ID: 948781445

View in Genome Browser
Species Human (GRCh38)
Location 2:240324189-240324211
Sequence GGATGGTGTGGTGCCCGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948781445_948781454 11 Left 948781445 2:240324189-240324211 CCAGGCCGGGCACCACACCATCC No data
Right 948781454 2:240324223-240324245 CACATCCCTCAAACAGCAGTGGG No data
948781445_948781459 18 Left 948781445 2:240324189-240324211 CCAGGCCGGGCACCACACCATCC No data
Right 948781459 2:240324230-240324252 CTCAAACAGCAGTGGGGCCCGGG No data
948781445_948781453 10 Left 948781445 2:240324189-240324211 CCAGGCCGGGCACCACACCATCC No data
Right 948781453 2:240324222-240324244 CCACATCCCTCAAACAGCAGTGG No data
948781445_948781458 17 Left 948781445 2:240324189-240324211 CCAGGCCGGGCACCACACCATCC No data
Right 948781458 2:240324229-240324251 CCTCAAACAGCAGTGGGGCCCGG No data
948781445_948781455 12 Left 948781445 2:240324189-240324211 CCAGGCCGGGCACCACACCATCC No data
Right 948781455 2:240324224-240324246 ACATCCCTCAAACAGCAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948781445 Original CRISPR GGATGGTGTGGTGCCCGGCC TGG (reversed) Intergenic
No off target data available for this crispr