ID: 948781449

View in Genome Browser
Species Human (GRCh38)
Location 2:240324210-240324232
Sequence GAGGGATGTGGGGACTGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948781449_948781454 -10 Left 948781449 2:240324210-240324232 CCATCACAGTCCCCACATCCCTC No data
Right 948781454 2:240324223-240324245 CACATCCCTCAAACAGCAGTGGG No data
948781449_948781458 -4 Left 948781449 2:240324210-240324232 CCATCACAGTCCCCACATCCCTC No data
Right 948781458 2:240324229-240324251 CCTCAAACAGCAGTGGGGCCCGG No data
948781449_948781464 25 Left 948781449 2:240324210-240324232 CCATCACAGTCCCCACATCCCTC No data
Right 948781464 2:240324258-240324280 GCAGCTCCTCCATGCCCTGGCGG No data
948781449_948781463 22 Left 948781449 2:240324210-240324232 CCATCACAGTCCCCACATCCCTC No data
Right 948781463 2:240324255-240324277 CCAGCAGCTCCTCCATGCCCTGG No data
948781449_948781455 -9 Left 948781449 2:240324210-240324232 CCATCACAGTCCCCACATCCCTC No data
Right 948781455 2:240324224-240324246 ACATCCCTCAAACAGCAGTGGGG No data
948781449_948781459 -3 Left 948781449 2:240324210-240324232 CCATCACAGTCCCCACATCCCTC No data
Right 948781459 2:240324230-240324252 CTCAAACAGCAGTGGGGCCCGGG No data
948781449_948781465 26 Left 948781449 2:240324210-240324232 CCATCACAGTCCCCACATCCCTC No data
Right 948781465 2:240324259-240324281 CAGCTCCTCCATGCCCTGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948781449 Original CRISPR GAGGGATGTGGGGACTGTGA TGG (reversed) Intergenic
No off target data available for this crispr