ID: 948781459

View in Genome Browser
Species Human (GRCh38)
Location 2:240324230-240324252
Sequence CTCAAACAGCAGTGGGGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948781445_948781459 18 Left 948781445 2:240324189-240324211 CCAGGCCGGGCACCACACCATCC No data
Right 948781459 2:240324230-240324252 CTCAAACAGCAGTGGGGCCCGGG No data
948781446_948781459 13 Left 948781446 2:240324194-240324216 CCGGGCACCACACCATCCATCAC No data
Right 948781459 2:240324230-240324252 CTCAAACAGCAGTGGGGCCCGGG No data
948781441_948781459 30 Left 948781441 2:240324177-240324199 CCCTTCGGGGCCCCAGGCCGGGC No data
Right 948781459 2:240324230-240324252 CTCAAACAGCAGTGGGGCCCGGG No data
948781442_948781459 29 Left 948781442 2:240324178-240324200 CCTTCGGGGCCCCAGGCCGGGCA No data
Right 948781459 2:240324230-240324252 CTCAAACAGCAGTGGGGCCCGGG No data
948781449_948781459 -3 Left 948781449 2:240324210-240324232 CCATCACAGTCCCCACATCCCTC No data
Right 948781459 2:240324230-240324252 CTCAAACAGCAGTGGGGCCCGGG No data
948781443_948781459 20 Left 948781443 2:240324187-240324209 CCCCAGGCCGGGCACCACACCAT No data
Right 948781459 2:240324230-240324252 CTCAAACAGCAGTGGGGCCCGGG No data
948781447_948781459 6 Left 948781447 2:240324201-240324223 CCACACCATCCATCACAGTCCCC No data
Right 948781459 2:240324230-240324252 CTCAAACAGCAGTGGGGCCCGGG No data
948781448_948781459 1 Left 948781448 2:240324206-240324228 CCATCCATCACAGTCCCCACATC No data
Right 948781459 2:240324230-240324252 CTCAAACAGCAGTGGGGCCCGGG No data
948781444_948781459 19 Left 948781444 2:240324188-240324210 CCCAGGCCGGGCACCACACCATC No data
Right 948781459 2:240324230-240324252 CTCAAACAGCAGTGGGGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948781459 Original CRISPR CTCAAACAGCAGTGGGGCCC GGG Intergenic
No off target data available for this crispr