ID: 948782203

View in Genome Browser
Species Human (GRCh38)
Location 2:240328805-240328827
Sequence CCTTCCATTCAGGGGCTGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948782203_948782210 9 Left 948782203 2:240328805-240328827 CCCGGCAGCCCCTGAATGGAAGG No data
Right 948782210 2:240328837-240328859 CTCCTCTCCCTTCCTTGTACAGG No data
948782203_948782214 18 Left 948782203 2:240328805-240328827 CCCGGCAGCCCCTGAATGGAAGG No data
Right 948782214 2:240328846-240328868 CTTCCTTGTACAGGCATCTGAGG No data
948782203_948782215 19 Left 948782203 2:240328805-240328827 CCCGGCAGCCCCTGAATGGAAGG No data
Right 948782215 2:240328847-240328869 TTCCTTGTACAGGCATCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948782203 Original CRISPR CCTTCCATTCAGGGGCTGCC GGG (reversed) Intergenic
No off target data available for this crispr