ID: 948782634

View in Genome Browser
Species Human (GRCh38)
Location 2:240332180-240332202
Sequence GGCACAGATGTGCAGCCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948782630_948782634 5 Left 948782630 2:240332152-240332174 CCAGGAGAGAAAAGATGAAGACA No data
Right 948782634 2:240332180-240332202 GGCACAGATGTGCAGCCATCTGG No data
948782629_948782634 6 Left 948782629 2:240332151-240332173 CCCAGGAGAGAAAAGATGAAGAC No data
Right 948782634 2:240332180-240332202 GGCACAGATGTGCAGCCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948782634 Original CRISPR GGCACAGATGTGCAGCCATC TGG Intergenic
No off target data available for this crispr