ID: 948783564

View in Genome Browser
Species Human (GRCh38)
Location 2:240339638-240339660
Sequence GCCCCTCTGCCTCTTCTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948783561_948783564 13 Left 948783561 2:240339602-240339624 CCTGAGGGGGATGCATCAAACCT No data
Right 948783564 2:240339638-240339660 GCCCCTCTGCCTCTTCTCACAGG No data
948783562_948783564 -7 Left 948783562 2:240339622-240339644 CCTGTTCGTGCCTTCAGCCCCTC No data
Right 948783564 2:240339638-240339660 GCCCCTCTGCCTCTTCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948783564 Original CRISPR GCCCCTCTGCCTCTTCTCAC AGG Intergenic
No off target data available for this crispr