ID: 948783716

View in Genome Browser
Species Human (GRCh38)
Location 2:240340257-240340279
Sequence CATCCCGGGCAGACACTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948783716_948783723 -4 Left 948783716 2:240340257-240340279 CCTTCCAGTGTCTGCCCGGGATG No data
Right 948783723 2:240340276-240340298 GATGGAGGAGGCCTTTCCCATGG No data
948783716_948783724 3 Left 948783716 2:240340257-240340279 CCTTCCAGTGTCTGCCCGGGATG No data
Right 948783724 2:240340283-240340305 GAGGCCTTTCCCATGGCCAGTGG No data
948783716_948783725 6 Left 948783716 2:240340257-240340279 CCTTCCAGTGTCTGCCCGGGATG No data
Right 948783725 2:240340286-240340308 GCCTTTCCCATGGCCAGTGGCGG No data
948783716_948783727 7 Left 948783716 2:240340257-240340279 CCTTCCAGTGTCTGCCCGGGATG No data
Right 948783727 2:240340287-240340309 CCTTTCCCATGGCCAGTGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948783716 Original CRISPR CATCCCGGGCAGACACTGGA AGG (reversed) Intergenic
No off target data available for this crispr