ID: 948785579

View in Genome Browser
Species Human (GRCh38)
Location 2:240350742-240350764
Sequence GTGTCCTCTCTTACAGCTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948785579_948785588 29 Left 948785579 2:240350742-240350764 CCCGGAGCTGTAAGAGAGGACAC No data
Right 948785588 2:240350794-240350816 GCAATCTGTGGCAACGGCAATGG No data
948785579_948785581 1 Left 948785579 2:240350742-240350764 CCCGGAGCTGTAAGAGAGGACAC No data
Right 948785581 2:240350766-240350788 TGTGCTGTTTCAAGCCCCTCAGG No data
948785579_948785582 7 Left 948785579 2:240350742-240350764 CCCGGAGCTGTAAGAGAGGACAC No data
Right 948785582 2:240350772-240350794 GTTTCAAGCCCCTCAGGCTGTGG No data
948785579_948785589 30 Left 948785579 2:240350742-240350764 CCCGGAGCTGTAAGAGAGGACAC No data
Right 948785589 2:240350795-240350817 CAATCTGTGGCAACGGCAATGGG No data
948785579_948785587 23 Left 948785579 2:240350742-240350764 CCCGGAGCTGTAAGAGAGGACAC No data
Right 948785587 2:240350788-240350810 GCTGTGGCAATCTGTGGCAACGG No data
948785579_948785586 17 Left 948785579 2:240350742-240350764 CCCGGAGCTGTAAGAGAGGACAC No data
Right 948785586 2:240350782-240350804 CCTCAGGCTGTGGCAATCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948785579 Original CRISPR GTGTCCTCTCTTACAGCTCC GGG (reversed) Intergenic
No off target data available for this crispr