ID: 948786752

View in Genome Browser
Species Human (GRCh38)
Location 2:240356682-240356704
Sequence GCTGGCTCTTGGAATTCGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948786752_948786757 -5 Left 948786752 2:240356682-240356704 CCCACCGAATTCCAAGAGCCAGC No data
Right 948786757 2:240356700-240356722 CCAGCAAAAAAGCAAAGCAATGG No data
948786752_948786760 30 Left 948786752 2:240356682-240356704 CCCACCGAATTCCAAGAGCCAGC No data
Right 948786760 2:240356735-240356757 AGGGACATGAACTTTAGACCTGG No data
948786752_948786759 11 Left 948786752 2:240356682-240356704 CCCACCGAATTCCAAGAGCCAGC No data
Right 948786759 2:240356716-240356738 GCAATGGTTCAGAGCATTGAGGG No data
948786752_948786758 10 Left 948786752 2:240356682-240356704 CCCACCGAATTCCAAGAGCCAGC No data
Right 948786758 2:240356715-240356737 AGCAATGGTTCAGAGCATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948786752 Original CRISPR GCTGGCTCTTGGAATTCGGT GGG (reversed) Intergenic
No off target data available for this crispr