ID: 948786755

View in Genome Browser
Species Human (GRCh38)
Location 2:240356693-240356715
Sequence TTTGCTTTTTTGCTGGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948786755_948786759 0 Left 948786755 2:240356693-240356715 CCAAGAGCCAGCAAAAAAGCAAA No data
Right 948786759 2:240356716-240356738 GCAATGGTTCAGAGCATTGAGGG No data
948786755_948786758 -1 Left 948786755 2:240356693-240356715 CCAAGAGCCAGCAAAAAAGCAAA No data
Right 948786758 2:240356715-240356737 AGCAATGGTTCAGAGCATTGAGG No data
948786755_948786760 19 Left 948786755 2:240356693-240356715 CCAAGAGCCAGCAAAAAAGCAAA No data
Right 948786760 2:240356735-240356757 AGGGACATGAACTTTAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948786755 Original CRISPR TTTGCTTTTTTGCTGGCTCT TGG (reversed) Intergenic