ID: 948786757

View in Genome Browser
Species Human (GRCh38)
Location 2:240356700-240356722
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948786754_948786757 -9 Left 948786754 2:240356686-240356708 CCGAATTCCAAGAGCCAGCAAAA No data
Right 948786757 2:240356700-240356722 CCAGCAAAAAAGCAAAGCAATGG No data
948786752_948786757 -5 Left 948786752 2:240356682-240356704 CCCACCGAATTCCAAGAGCCAGC No data
Right 948786757 2:240356700-240356722 CCAGCAAAAAAGCAAAGCAATGG No data
948786749_948786757 19 Left 948786749 2:240356658-240356680 CCAGCGTGAGATTCATCACCTTG No data
Right 948786757 2:240356700-240356722 CCAGCAAAAAAGCAAAGCAATGG No data
948786750_948786757 1 Left 948786750 2:240356676-240356698 CCTTGCCCCACCGAATTCCAAGA No data
Right 948786757 2:240356700-240356722 CCAGCAAAAAAGCAAAGCAATGG No data
948786753_948786757 -6 Left 948786753 2:240356683-240356705 CCACCGAATTCCAAGAGCCAGCA No data
Right 948786757 2:240356700-240356722 CCAGCAAAAAAGCAAAGCAATGG No data
948786748_948786757 29 Left 948786748 2:240356648-240356670 CCTCTGAGTACCAGCGTGAGATT No data
Right 948786757 2:240356700-240356722 CCAGCAAAAAAGCAAAGCAATGG No data
948786751_948786757 -4 Left 948786751 2:240356681-240356703 CCCCACCGAATTCCAAGAGCCAG No data
Right 948786757 2:240356700-240356722 CCAGCAAAAAAGCAAAGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type