ID: 948786758

View in Genome Browser
Species Human (GRCh38)
Location 2:240356715-240356737
Sequence AGCAATGGTTCAGAGCATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948786754_948786758 6 Left 948786754 2:240356686-240356708 CCGAATTCCAAGAGCCAGCAAAA No data
Right 948786758 2:240356715-240356737 AGCAATGGTTCAGAGCATTGAGG No data
948786756_948786758 -8 Left 948786756 2:240356700-240356722 CCAGCAAAAAAGCAAAGCAATGG No data
Right 948786758 2:240356715-240356737 AGCAATGGTTCAGAGCATTGAGG No data
948786755_948786758 -1 Left 948786755 2:240356693-240356715 CCAAGAGCCAGCAAAAAAGCAAA No data
Right 948786758 2:240356715-240356737 AGCAATGGTTCAGAGCATTGAGG No data
948786753_948786758 9 Left 948786753 2:240356683-240356705 CCACCGAATTCCAAGAGCCAGCA No data
Right 948786758 2:240356715-240356737 AGCAATGGTTCAGAGCATTGAGG No data
948786751_948786758 11 Left 948786751 2:240356681-240356703 CCCCACCGAATTCCAAGAGCCAG No data
Right 948786758 2:240356715-240356737 AGCAATGGTTCAGAGCATTGAGG No data
948786752_948786758 10 Left 948786752 2:240356682-240356704 CCCACCGAATTCCAAGAGCCAGC No data
Right 948786758 2:240356715-240356737 AGCAATGGTTCAGAGCATTGAGG No data
948786750_948786758 16 Left 948786750 2:240356676-240356698 CCTTGCCCCACCGAATTCCAAGA No data
Right 948786758 2:240356715-240356737 AGCAATGGTTCAGAGCATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948786758 Original CRISPR AGCAATGGTTCAGAGCATTG AGG Intergenic