ID: 948786759

View in Genome Browser
Species Human (GRCh38)
Location 2:240356716-240356738
Sequence GCAATGGTTCAGAGCATTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948786756_948786759 -7 Left 948786756 2:240356700-240356722 CCAGCAAAAAAGCAAAGCAATGG No data
Right 948786759 2:240356716-240356738 GCAATGGTTCAGAGCATTGAGGG No data
948786751_948786759 12 Left 948786751 2:240356681-240356703 CCCCACCGAATTCCAAGAGCCAG No data
Right 948786759 2:240356716-240356738 GCAATGGTTCAGAGCATTGAGGG No data
948786750_948786759 17 Left 948786750 2:240356676-240356698 CCTTGCCCCACCGAATTCCAAGA No data
Right 948786759 2:240356716-240356738 GCAATGGTTCAGAGCATTGAGGG No data
948786755_948786759 0 Left 948786755 2:240356693-240356715 CCAAGAGCCAGCAAAAAAGCAAA No data
Right 948786759 2:240356716-240356738 GCAATGGTTCAGAGCATTGAGGG No data
948786752_948786759 11 Left 948786752 2:240356682-240356704 CCCACCGAATTCCAAGAGCCAGC No data
Right 948786759 2:240356716-240356738 GCAATGGTTCAGAGCATTGAGGG No data
948786754_948786759 7 Left 948786754 2:240356686-240356708 CCGAATTCCAAGAGCCAGCAAAA No data
Right 948786759 2:240356716-240356738 GCAATGGTTCAGAGCATTGAGGG No data
948786753_948786759 10 Left 948786753 2:240356683-240356705 CCACCGAATTCCAAGAGCCAGCA No data
Right 948786759 2:240356716-240356738 GCAATGGTTCAGAGCATTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948786759 Original CRISPR GCAATGGTTCAGAGCATTGA GGG Intergenic
No off target data available for this crispr