ID: 948786760

View in Genome Browser
Species Human (GRCh38)
Location 2:240356735-240356757
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948786753_948786760 29 Left 948786753 2:240356683-240356705 CCACCGAATTCCAAGAGCCAGCA No data
Right 948786760 2:240356735-240356757 AGGGACATGAACTTTAGACCTGG No data
948786754_948786760 26 Left 948786754 2:240356686-240356708 CCGAATTCCAAGAGCCAGCAAAA No data
Right 948786760 2:240356735-240356757 AGGGACATGAACTTTAGACCTGG No data
948786755_948786760 19 Left 948786755 2:240356693-240356715 CCAAGAGCCAGCAAAAAAGCAAA No data
Right 948786760 2:240356735-240356757 AGGGACATGAACTTTAGACCTGG No data
948786756_948786760 12 Left 948786756 2:240356700-240356722 CCAGCAAAAAAGCAAAGCAATGG No data
Right 948786760 2:240356735-240356757 AGGGACATGAACTTTAGACCTGG No data
948786752_948786760 30 Left 948786752 2:240356682-240356704 CCCACCGAATTCCAAGAGCCAGC No data
Right 948786760 2:240356735-240356757 AGGGACATGAACTTTAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr