ID: 948787766

View in Genome Browser
Species Human (GRCh38)
Location 2:240361880-240361902
Sequence AGGCCCAGTGGAGCAGGTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948787760_948787766 10 Left 948787760 2:240361847-240361869 CCGAGAATGTCTGCAGGGCCCAG No data
Right 948787766 2:240361880-240361902 AGGCCCAGTGGAGCAGGTGCCGG No data
948787763_948787766 -9 Left 948787763 2:240361866-240361888 CCAGAGATGTGTGCAGGCCCAGT No data
Right 948787766 2:240361880-240361902 AGGCCCAGTGGAGCAGGTGCCGG No data
948787762_948787766 -8 Left 948787762 2:240361865-240361887 CCCAGAGATGTGTGCAGGCCCAG No data
Right 948787766 2:240361880-240361902 AGGCCCAGTGGAGCAGGTGCCGG No data
948787757_948787766 17 Left 948787757 2:240361840-240361862 CCAGCAGCCGAGAATGTCTGCAG No data
Right 948787766 2:240361880-240361902 AGGCCCAGTGGAGCAGGTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948787766 Original CRISPR AGGCCCAGTGGAGCAGGTGC CGG Intergenic
No off target data available for this crispr