ID: 948788154

View in Genome Browser
Species Human (GRCh38)
Location 2:240363789-240363811
Sequence CTGCTGTCCTTGGGGAGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948788154_948788162 15 Left 948788154 2:240363789-240363811 CCACATCTCCCCAAGGACAGCAG No data
Right 948788162 2:240363827-240363849 ATCCCCCGCCTGCCTGTCCCCGG No data
948788154_948788168 26 Left 948788154 2:240363789-240363811 CCACATCTCCCCAAGGACAGCAG No data
Right 948788168 2:240363838-240363860 GCCTGTCCCCGGCAAAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948788154 Original CRISPR CTGCTGTCCTTGGGGAGATG TGG (reversed) Intergenic
No off target data available for this crispr