ID: 948789845

View in Genome Browser
Species Human (GRCh38)
Location 2:240371578-240371600
Sequence TCCCCTGGAAGGGGCCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948789838_948789845 -3 Left 948789838 2:240371558-240371580 CCTTGCTTGGGATCCAGCCTTCC No data
Right 948789845 2:240371578-240371600 TCCCCTGGAAGGGGCCCTGCAGG No data
948789835_948789845 3 Left 948789835 2:240371552-240371574 CCCTTCCCTTGCTTGGGATCCAG No data
Right 948789845 2:240371578-240371600 TCCCCTGGAAGGGGCCCTGCAGG No data
948789836_948789845 2 Left 948789836 2:240371553-240371575 CCTTCCCTTGCTTGGGATCCAGC No data
Right 948789845 2:240371578-240371600 TCCCCTGGAAGGGGCCCTGCAGG No data
948789837_948789845 -2 Left 948789837 2:240371557-240371579 CCCTTGCTTGGGATCCAGCCTTC No data
Right 948789845 2:240371578-240371600 TCCCCTGGAAGGGGCCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948789845 Original CRISPR TCCCCTGGAAGGGGCCCTGC AGG Intergenic
No off target data available for this crispr