ID: 948790882

View in Genome Browser
Species Human (GRCh38)
Location 2:240376284-240376306
Sequence CTCTGCCCATGTAATAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948790882_948790891 9 Left 948790882 2:240376284-240376306 CCATCTTTATTACATGGGCAGAG No data
Right 948790891 2:240376316-240376338 GGAGGAAGGTACATGTGTCCAGG No data
948790882_948790887 -9 Left 948790882 2:240376284-240376306 CCATCTTTATTACATGGGCAGAG No data
Right 948790887 2:240376298-240376320 TGGGCAGAGGGCCTCCTGGGAGG No data
948790882_948790893 25 Left 948790882 2:240376284-240376306 CCATCTTTATTACATGGGCAGAG No data
Right 948790893 2:240376332-240376354 GTCCAGGGCTCCAGAGCACAAGG No data
948790882_948790892 10 Left 948790882 2:240376284-240376306 CCATCTTTATTACATGGGCAGAG No data
Right 948790892 2:240376317-240376339 GAGGAAGGTACATGTGTCCAGGG No data
948790882_948790888 -5 Left 948790882 2:240376284-240376306 CCATCTTTATTACATGGGCAGAG No data
Right 948790888 2:240376302-240376324 CAGAGGGCCTCCTGGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948790882 Original CRISPR CTCTGCCCATGTAATAAAGA TGG (reversed) Intergenic
No off target data available for this crispr