ID: 948792714

View in Genome Browser
Species Human (GRCh38)
Location 2:240387551-240387573
Sequence GGAGCAGCCCAGAAATCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948792714_948792717 -6 Left 948792714 2:240387551-240387573 CCCTCAGATTTCTGGGCTGCTCC No data
Right 948792717 2:240387568-240387590 TGCTCCACTGCACTGGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948792714 Original CRISPR GGAGCAGCCCAGAAATCTGA GGG (reversed) Intergenic
No off target data available for this crispr