ID: 948795945

View in Genome Browser
Species Human (GRCh38)
Location 2:240402165-240402187
Sequence GAATCCTGGGGTGCAGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948795945_948795952 1 Left 948795945 2:240402165-240402187 CCTGTCCCTGCACCCCAGGATTC No data
Right 948795952 2:240402189-240402211 TGCACCCCACGCCCAGAGCAAGG No data
948795945_948795958 19 Left 948795945 2:240402165-240402187 CCTGTCCCTGCACCCCAGGATTC No data
Right 948795958 2:240402207-240402229 CAAGGCACACCCCTCCCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948795945 Original CRISPR GAATCCTGGGGTGCAGGGAC AGG (reversed) Intergenic
No off target data available for this crispr