ID: 948797418

View in Genome Browser
Species Human (GRCh38)
Location 2:240412080-240412102
Sequence CTGTGTGCGGGGAAGGAGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948797418_948797424 8 Left 948797418 2:240412080-240412102 CCGTTCTCCTTCCCCGCACACAG No data
Right 948797424 2:240412111-240412133 TCCTTGATATGTCAAAGATCAGG No data
948797418_948797426 28 Left 948797418 2:240412080-240412102 CCGTTCTCCTTCCCCGCACACAG No data
Right 948797426 2:240412131-240412153 AGGAGCCAGCCACCTTCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948797418 Original CRISPR CTGTGTGCGGGGAAGGAGAA CGG (reversed) Intergenic
No off target data available for this crispr