ID: 948797656

View in Genome Browser
Species Human (GRCh38)
Location 2:240412999-240413021
Sequence GTGCAGTCCACCCTGGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948797650_948797656 1 Left 948797650 2:240412975-240412997 CCGCCTGTCCAGAGTGTCACAGA No data
Right 948797656 2:240412999-240413021 GTGCAGTCCACCCTGGGGACAGG No data
948797643_948797656 29 Left 948797643 2:240412947-240412969 CCCAAGGGCCGCAGACCATCCCA No data
Right 948797656 2:240412999-240413021 GTGCAGTCCACCCTGGGGACAGG No data
948797644_948797656 28 Left 948797644 2:240412948-240412970 CCAAGGGCCGCAGACCATCCCAA No data
Right 948797656 2:240412999-240413021 GTGCAGTCCACCCTGGGGACAGG No data
948797646_948797656 21 Left 948797646 2:240412955-240412977 CCGCAGACCATCCCAAAGGACCG No data
Right 948797656 2:240412999-240413021 GTGCAGTCCACCCTGGGGACAGG No data
948797652_948797656 -7 Left 948797652 2:240412983-240413005 CCAGAGTGTCACAGACGTGCAGT No data
Right 948797656 2:240412999-240413021 GTGCAGTCCACCCTGGGGACAGG No data
948797649_948797656 9 Left 948797649 2:240412967-240412989 CCAAAGGACCGCCTGTCCAGAGT No data
Right 948797656 2:240412999-240413021 GTGCAGTCCACCCTGGGGACAGG No data
948797647_948797656 14 Left 948797647 2:240412962-240412984 CCATCCCAAAGGACCGCCTGTCC No data
Right 948797656 2:240412999-240413021 GTGCAGTCCACCCTGGGGACAGG No data
948797648_948797656 10 Left 948797648 2:240412966-240412988 CCCAAAGGACCGCCTGTCCAGAG No data
Right 948797656 2:240412999-240413021 GTGCAGTCCACCCTGGGGACAGG No data
948797651_948797656 -2 Left 948797651 2:240412978-240413000 CCTGTCCAGAGTGTCACAGACGT No data
Right 948797656 2:240412999-240413021 GTGCAGTCCACCCTGGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948797656 Original CRISPR GTGCAGTCCACCCTGGGGAC AGG Intergenic
No off target data available for this crispr