ID: 948797657

View in Genome Browser
Species Human (GRCh38)
Location 2:240413006-240413028
Sequence GACAGTGCCTGTCCCCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948797657_948797669 13 Left 948797657 2:240413006-240413028 CCACCCTGGGGACAGGCACTGTC No data
Right 948797669 2:240413042-240413064 CCACCACACTGGCCAGAGAAGGG No data
948797657_948797672 19 Left 948797657 2:240413006-240413028 CCACCCTGGGGACAGGCACTGTC No data
Right 948797672 2:240413048-240413070 CACTGGCCAGAGAAGGGGTGAGG No data
948797657_948797663 2 Left 948797657 2:240413006-240413028 CCACCCTGGGGACAGGCACTGTC No data
Right 948797663 2:240413031-240413053 CCCCTGCAGGCCCACCACACTGG No data
948797657_948797667 12 Left 948797657 2:240413006-240413028 CCACCCTGGGGACAGGCACTGTC No data
Right 948797667 2:240413041-240413063 CCCACCACACTGGCCAGAGAAGG No data
948797657_948797670 14 Left 948797657 2:240413006-240413028 CCACCCTGGGGACAGGCACTGTC No data
Right 948797670 2:240413043-240413065 CACCACACTGGCCAGAGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948797657 Original CRISPR GACAGTGCCTGTCCCCAGGG TGG (reversed) Intergenic