ID: 948797658

View in Genome Browser
Species Human (GRCh38)
Location 2:240413009-240413031
Sequence GAGGACAGTGCCTGTCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948797658_948797663 -1 Left 948797658 2:240413009-240413031 CCCTGGGGACAGGCACTGTCCTC No data
Right 948797663 2:240413031-240413053 CCCCTGCAGGCCCACCACACTGG No data
948797658_948797669 10 Left 948797658 2:240413009-240413031 CCCTGGGGACAGGCACTGTCCTC No data
Right 948797669 2:240413042-240413064 CCACCACACTGGCCAGAGAAGGG No data
948797658_948797667 9 Left 948797658 2:240413009-240413031 CCCTGGGGACAGGCACTGTCCTC No data
Right 948797667 2:240413041-240413063 CCCACCACACTGGCCAGAGAAGG No data
948797658_948797672 16 Left 948797658 2:240413009-240413031 CCCTGGGGACAGGCACTGTCCTC No data
Right 948797672 2:240413048-240413070 CACTGGCCAGAGAAGGGGTGAGG No data
948797658_948797670 11 Left 948797658 2:240413009-240413031 CCCTGGGGACAGGCACTGTCCTC No data
Right 948797670 2:240413043-240413065 CACCACACTGGCCAGAGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948797658 Original CRISPR GAGGACAGTGCCTGTCCCCA GGG (reversed) Intergenic