ID: 948797659

View in Genome Browser
Species Human (GRCh38)
Location 2:240413010-240413032
Sequence GGAGGACAGTGCCTGTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948797659_948797669 9 Left 948797659 2:240413010-240413032 CCTGGGGACAGGCACTGTCCTCC No data
Right 948797669 2:240413042-240413064 CCACCACACTGGCCAGAGAAGGG No data
948797659_948797670 10 Left 948797659 2:240413010-240413032 CCTGGGGACAGGCACTGTCCTCC No data
Right 948797670 2:240413043-240413065 CACCACACTGGCCAGAGAAGGGG No data
948797659_948797674 30 Left 948797659 2:240413010-240413032 CCTGGGGACAGGCACTGTCCTCC No data
Right 948797674 2:240413063-240413085 GGGTGAGGCCAAGCCTCACCTGG No data
948797659_948797667 8 Left 948797659 2:240413010-240413032 CCTGGGGACAGGCACTGTCCTCC No data
Right 948797667 2:240413041-240413063 CCCACCACACTGGCCAGAGAAGG No data
948797659_948797672 15 Left 948797659 2:240413010-240413032 CCTGGGGACAGGCACTGTCCTCC No data
Right 948797672 2:240413048-240413070 CACTGGCCAGAGAAGGGGTGAGG No data
948797659_948797663 -2 Left 948797659 2:240413010-240413032 CCTGGGGACAGGCACTGTCCTCC No data
Right 948797663 2:240413031-240413053 CCCCTGCAGGCCCACCACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948797659 Original CRISPR GGAGGACAGTGCCTGTCCCC AGG (reversed) Intergenic