ID: 948797661

View in Genome Browser
Species Human (GRCh38)
Location 2:240413028-240413050
Sequence GTGTGGTGGGCCTGCAGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948797661_948797674 12 Left 948797661 2:240413028-240413050 CCTCCCCTGCAGGCCCACCACAC No data
Right 948797674 2:240413063-240413085 GGGTGAGGCCAAGCCTCACCTGG No data
948797661_948797669 -9 Left 948797661 2:240413028-240413050 CCTCCCCTGCAGGCCCACCACAC No data
Right 948797669 2:240413042-240413064 CCACCACACTGGCCAGAGAAGGG No data
948797661_948797672 -3 Left 948797661 2:240413028-240413050 CCTCCCCTGCAGGCCCACCACAC No data
Right 948797672 2:240413048-240413070 CACTGGCCAGAGAAGGGGTGAGG No data
948797661_948797678 28 Left 948797661 2:240413028-240413050 CCTCCCCTGCAGGCCCACCACAC No data
Right 948797678 2:240413079-240413101 CACCTGGCTCCCGCTGAGGCTGG No data
948797661_948797670 -8 Left 948797661 2:240413028-240413050 CCTCCCCTGCAGGCCCACCACAC No data
Right 948797670 2:240413043-240413065 CACCACACTGGCCAGAGAAGGGG No data
948797661_948797676 24 Left 948797661 2:240413028-240413050 CCTCCCCTGCAGGCCCACCACAC No data
Right 948797676 2:240413075-240413097 GCCTCACCTGGCTCCCGCTGAGG No data
948797661_948797667 -10 Left 948797661 2:240413028-240413050 CCTCCCCTGCAGGCCCACCACAC No data
Right 948797667 2:240413041-240413063 CCCACCACACTGGCCAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948797661 Original CRISPR GTGTGGTGGGCCTGCAGGGG AGG (reversed) Intergenic