ID: 948797663

View in Genome Browser
Species Human (GRCh38)
Location 2:240413031-240413053
Sequence CCCCTGCAGGCCCACCACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948797657_948797663 2 Left 948797657 2:240413006-240413028 CCACCCTGGGGACAGGCACTGTC No data
Right 948797663 2:240413031-240413053 CCCCTGCAGGCCCACCACACTGG No data
948797658_948797663 -1 Left 948797658 2:240413009-240413031 CCCTGGGGACAGGCACTGTCCTC No data
Right 948797663 2:240413031-240413053 CCCCTGCAGGCCCACCACACTGG No data
948797652_948797663 25 Left 948797652 2:240412983-240413005 CCAGAGTGTCACAGACGTGCAGT No data
Right 948797663 2:240413031-240413053 CCCCTGCAGGCCCACCACACTGG No data
948797651_948797663 30 Left 948797651 2:240412978-240413000 CCTGTCCAGAGTGTCACAGACGT No data
Right 948797663 2:240413031-240413053 CCCCTGCAGGCCCACCACACTGG No data
948797659_948797663 -2 Left 948797659 2:240413010-240413032 CCTGGGGACAGGCACTGTCCTCC No data
Right 948797663 2:240413031-240413053 CCCCTGCAGGCCCACCACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948797663 Original CRISPR CCCCTGCAGGCCCACCACAC TGG Intergenic