ID: 948797670

View in Genome Browser
Species Human (GRCh38)
Location 2:240413043-240413065
Sequence CACCACACTGGCCAGAGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948797661_948797670 -8 Left 948797661 2:240413028-240413050 CCTCCCCTGCAGGCCCACCACAC No data
Right 948797670 2:240413043-240413065 CACCACACTGGCCAGAGAAGGGG No data
948797659_948797670 10 Left 948797659 2:240413010-240413032 CCTGGGGACAGGCACTGTCCTCC No data
Right 948797670 2:240413043-240413065 CACCACACTGGCCAGAGAAGGGG No data
948797657_948797670 14 Left 948797657 2:240413006-240413028 CCACCCTGGGGACAGGCACTGTC No data
Right 948797670 2:240413043-240413065 CACCACACTGGCCAGAGAAGGGG No data
948797658_948797670 11 Left 948797658 2:240413009-240413031 CCCTGGGGACAGGCACTGTCCTC No data
Right 948797670 2:240413043-240413065 CACCACACTGGCCAGAGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948797670 Original CRISPR CACCACACTGGCCAGAGAAG GGG Intergenic