ID: 948797672

View in Genome Browser
Species Human (GRCh38)
Location 2:240413048-240413070
Sequence CACTGGCCAGAGAAGGGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948797657_948797672 19 Left 948797657 2:240413006-240413028 CCACCCTGGGGACAGGCACTGTC No data
Right 948797672 2:240413048-240413070 CACTGGCCAGAGAAGGGGTGAGG No data
948797659_948797672 15 Left 948797659 2:240413010-240413032 CCTGGGGACAGGCACTGTCCTCC No data
Right 948797672 2:240413048-240413070 CACTGGCCAGAGAAGGGGTGAGG No data
948797665_948797672 -8 Left 948797665 2:240413033-240413055 CCTGCAGGCCCACCACACTGGCC No data
Right 948797672 2:240413048-240413070 CACTGGCCAGAGAAGGGGTGAGG No data
948797661_948797672 -3 Left 948797661 2:240413028-240413050 CCTCCCCTGCAGGCCCACCACAC No data
Right 948797672 2:240413048-240413070 CACTGGCCAGAGAAGGGGTGAGG No data
948797664_948797672 -7 Left 948797664 2:240413032-240413054 CCCTGCAGGCCCACCACACTGGC No data
Right 948797672 2:240413048-240413070 CACTGGCCAGAGAAGGGGTGAGG No data
948797658_948797672 16 Left 948797658 2:240413009-240413031 CCCTGGGGACAGGCACTGTCCTC No data
Right 948797672 2:240413048-240413070 CACTGGCCAGAGAAGGGGTGAGG No data
948797662_948797672 -6 Left 948797662 2:240413031-240413053 CCCCTGCAGGCCCACCACACTGG No data
Right 948797672 2:240413048-240413070 CACTGGCCAGAGAAGGGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948797672 Original CRISPR CACTGGCCAGAGAAGGGGTG AGG Intergenic