ID: 948797674

View in Genome Browser
Species Human (GRCh38)
Location 2:240413063-240413085
Sequence GGGTGAGGCCAAGCCTCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948797671_948797674 -5 Left 948797671 2:240413045-240413067 CCACACTGGCCAGAGAAGGGGTG No data
Right 948797674 2:240413063-240413085 GGGTGAGGCCAAGCCTCACCTGG No data
948797664_948797674 8 Left 948797664 2:240413032-240413054 CCCTGCAGGCCCACCACACTGGC No data
Right 948797674 2:240413063-240413085 GGGTGAGGCCAAGCCTCACCTGG No data
948797665_948797674 7 Left 948797665 2:240413033-240413055 CCTGCAGGCCCACCACACTGGCC No data
Right 948797674 2:240413063-240413085 GGGTGAGGCCAAGCCTCACCTGG No data
948797666_948797674 -1 Left 948797666 2:240413041-240413063 CCCACCACACTGGCCAGAGAAGG No data
Right 948797674 2:240413063-240413085 GGGTGAGGCCAAGCCTCACCTGG No data
948797662_948797674 9 Left 948797662 2:240413031-240413053 CCCCTGCAGGCCCACCACACTGG No data
Right 948797674 2:240413063-240413085 GGGTGAGGCCAAGCCTCACCTGG No data
948797661_948797674 12 Left 948797661 2:240413028-240413050 CCTCCCCTGCAGGCCCACCACAC No data
Right 948797674 2:240413063-240413085 GGGTGAGGCCAAGCCTCACCTGG No data
948797668_948797674 -2 Left 948797668 2:240413042-240413064 CCACCACACTGGCCAGAGAAGGG No data
Right 948797674 2:240413063-240413085 GGGTGAGGCCAAGCCTCACCTGG No data
948797659_948797674 30 Left 948797659 2:240413010-240413032 CCTGGGGACAGGCACTGTCCTCC No data
Right 948797674 2:240413063-240413085 GGGTGAGGCCAAGCCTCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948797674 Original CRISPR GGGTGAGGCCAAGCCTCACC TGG Intergenic