ID: 948798165

View in Genome Browser
Species Human (GRCh38)
Location 2:240416865-240416887
Sequence TTGTGTAAGTAGAAGAATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948798165_948798166 11 Left 948798165 2:240416865-240416887 CCTGAATTCTTCTACTTACACAA No data
Right 948798166 2:240416899-240416921 TTCCCTTTTCGCATGCCCCGAGG No data
948798165_948798169 21 Left 948798165 2:240416865-240416887 CCTGAATTCTTCTACTTACACAA No data
Right 948798169 2:240416909-240416931 GCATGCCCCGAGGCTGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948798165 Original CRISPR TTGTGTAAGTAGAAGAATTC AGG (reversed) Intergenic
No off target data available for this crispr