ID: 948800047

View in Genome Browser
Species Human (GRCh38)
Location 2:240429394-240429416
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948800047_948800054 21 Left 948800047 2:240429394-240429416 CCTCACCTGGCTGACAACCCTGC No data
Right 948800054 2:240429438-240429460 TGCTCATGTGACACTTACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948800047 Original CRISPR GCAGGGTTGTCAGCCAGGTG AGG (reversed) Intergenic
No off target data available for this crispr