ID: 948801674

View in Genome Browser
Species Human (GRCh38)
Location 2:240436063-240436085
Sequence GTGCCCCAGGCGGAGATCTC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 119}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948801669_948801674 0 Left 948801669 2:240436040-240436062 CCAAGGGCTTCAGCCTGAGCGAC 0: 1
1: 0
2: 2
3: 20
4: 297
Right 948801674 2:240436063-240436085 GTGCCCCAGGCGGAGATCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 119
948801668_948801674 14 Left 948801668 2:240436026-240436048 CCAGATCTACGGAGCCAAGGGCT 0: 1
1: 0
2: 0
3: 5
4: 57
Right 948801674 2:240436063-240436085 GTGCCCCAGGCGGAGATCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 119
948801665_948801674 17 Left 948801665 2:240436023-240436045 CCGCCAGATCTACGGAGCCAAGG 0: 1
1: 0
2: 0
3: 2
4: 60
Right 948801674 2:240436063-240436085 GTGCCCCAGGCGGAGATCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948801674 Original CRISPR GTGCCCCAGGCGGAGATCTC GGG Exonic
907399549 1:54216465-54216487 GTCCTCCAGGCAGAGATCCCGGG - Intronic
911611702 1:99965491-99965513 GGGGCCCAGGAGGAGATTTCAGG - Intergenic
914756979 1:150568360-150568382 GGGCCCCGGGCTGAGACCTCTGG + Intergenic
915903372 1:159861901-159861923 GGGCCCAAGGCTGAGGTCTCAGG + Intronic
917758551 1:178130367-178130389 GTGGCCCAGGGGGATATTTCAGG - Intronic
924024629 1:239819275-239819297 GTCCCCCTGCAGGAGATCTCTGG + Intronic
1062797450 10:355110-355132 CTGCCCCACGCTGAGAGCTCAGG - Intronic
1064029603 10:11875498-11875520 GTGCCCAGGGCGGAGAGGTCTGG - Intergenic
1064296763 10:14085639-14085661 GTTCCACAGGCTGAGCTCTCTGG - Intronic
1065551178 10:26869808-26869830 GTGCCCCAAGCTGAAAGCTCTGG + Intergenic
1072625042 10:97105881-97105903 GTGCCCTTGGCGGAGGCCTCCGG - Intronic
1075394283 10:122115368-122115390 ATGCCCCAGGAGGGGATGTCTGG + Intronic
1075444236 10:122502796-122502818 AGAGCCCAGGCGGAGATCTCAGG - Intronic
1076110176 10:127854123-127854145 GTGCCCAGGGCGCAGAGCTCTGG + Intergenic
1077198441 11:1293230-1293252 GTGCCCAAGGTGGAGCTCTCGGG - Intronic
1080707190 11:34707436-34707458 GTGCACCAGGCAGAGTTGTCAGG - Intergenic
1082054978 11:47806911-47806933 ATGCCACAAACGGAGATCTCAGG + Intronic
1083621833 11:64053147-64053169 GGGCCCCAGACGGAGAGCTGGGG + Intronic
1084411757 11:69009827-69009849 GTGCCACAGGCGGAGGGCCCTGG - Intronic
1084649660 11:70481772-70481794 GTCGCCCAGGCGGTGAACTCAGG + Intronic
1093774279 12:23054014-23054036 GTGCCACAGGAGGAGATGACTGG + Intergenic
1101441125 12:104704868-104704890 GTGCCCCAGGAGGAGTACTGAGG - Intronic
1101895490 12:108753487-108753509 GTGTCCCAGGCAGAGATTTTGGG - Intergenic
1104686561 12:130788732-130788754 GTGCCCCAGGCGTGGGTCTGTGG - Intergenic
1104692707 12:130838951-130838973 GTCCCCAGGGCGGGGATCTCCGG - Intronic
1106583558 13:31037855-31037877 GGGGACCAGGCGGAGCTCTCTGG + Intergenic
1107266953 13:38567272-38567294 CTGCCCCACACAGAGATCTCTGG + Intergenic
1112705329 13:102061393-102061415 GTGCCCCACGCGCAAACCTCTGG - Intronic
1120415940 14:84217904-84217926 GTGCACCAGGCAGAGTGCTCAGG + Intergenic
1121483450 14:94295548-94295570 GTGCCCCAGGCTGAGCTGTTAGG + Intergenic
1123939929 15:25211914-25211936 GTGGCCCTGCCGGAAATCTCGGG - Intergenic
1123945747 15:25238104-25238126 GTGGCCCTGCCGGGGATCTCAGG - Intergenic
1125477402 15:40056249-40056271 GGGCCACAGGCGCAGAGCTCTGG + Intergenic
1128173223 15:65530940-65530962 GAGGCCCAGGCCGAGCTCTCTGG - Intronic
1129191409 15:73939816-73939838 GTACCCCAGGAGGAGATCCTAGG - Intronic
1129496767 15:75990336-75990358 GTGCACCAAGCGGAGTACTCTGG - Intronic
1132525265 16:411104-411126 GTGCCCCAGGAGAGGATCTGTGG - Intronic
1133254693 16:4509553-4509575 CTGCCCCAGGAGGGGAGCTCAGG - Intronic
1141479339 16:84295916-84295938 GTTCCCCAGGCAGAGATGTGAGG - Intronic
1141951185 16:87340586-87340608 GTGCTTCAGGGAGAGATCTCAGG + Intronic
1142291050 16:89193692-89193714 GTGGCCCTGGTGGAGGTCTCAGG - Intronic
1142592672 17:1013213-1013235 CTGACCCACGGGGAGATCTCTGG - Intronic
1142852866 17:2712561-2712583 GTGCTCCAGGCAGAGAGCGCCGG + Intronic
1144407308 17:14964558-14964580 GTGAGCCAGGCAGAGATCTGTGG - Intergenic
1146722336 17:35132249-35132271 GTGCCACAGGCGGGGATCTGTGG + Exonic
1147179076 17:38673764-38673786 ATGTTCCTGGCGGAGATCTCCGG + Exonic
1148089375 17:45013667-45013689 GTGCCCCAGCAGGGGCTCTCTGG - Intergenic
1151370772 17:73644997-73645019 GCGCCCCGGCCGGAGCTCTCGGG + Intergenic
1152041437 17:77906359-77906381 ATGCCCCAGGTGGCAATCTCAGG - Intergenic
1152224085 17:79084714-79084736 CTGCCCAGGGCGGAGAGCTCAGG + Intronic
1152888747 17:82867931-82867953 GTCCCCCAGGGGGAGGACTCCGG + Intronic
1154066455 18:11111222-11111244 GTCCCCCAGATGGAGATCTCTGG + Intronic
1160251542 18:77207645-77207667 GTGCCCCTGGTGGAGATGTGTGG - Intergenic
1162337098 19:10068545-10068567 GTGCCCCAGGCTGGGAACTGTGG - Intergenic
1162404202 19:10463726-10463748 GTGTCCCAGTCTGAGACCTCAGG - Intronic
1165930621 19:39356124-39356146 GTGACCCTGGTGGAGATCTCAGG - Intronic
1166793083 19:45409394-45409416 GTGCCCCAAGAGGAGATGCCAGG + Exonic
926712023 2:15889550-15889572 CTGCCCCAGCTGGAGAGCTCGGG - Intergenic
927026388 2:19073098-19073120 CTGCCCCAGGCTGATGTCTCAGG + Intergenic
930196459 2:48515783-48515805 GTGCCACAGGCGGAGAGGTAAGG - Intergenic
936264952 2:110996959-110996981 TTCCCCCAGGCGTAGATCTGAGG + Intronic
938134044 2:128739206-128739228 GTCCCTCAGCCTGAGATCTCAGG - Intergenic
945998937 2:216464546-216464568 GTGCCCCAGTCTGAGAACTCTGG - Intronic
948801674 2:240436063-240436085 GTGCCCCAGGCGGAGATCTCGGG + Exonic
1170122753 20:12928010-12928032 GTGAACCAGGCTGAGAGCTCTGG + Intergenic
1175988481 20:62776135-62776157 GAGCCCCAGGCCGAGAGCTGTGG - Intergenic
1176056724 20:63152826-63152848 GTGCTTCAGGGGGAGAGCTCAGG + Intergenic
1176241412 20:64077425-64077447 CTGCCCCTGGCTGAGACCTCTGG - Intronic
1178916838 21:36709501-36709523 GCGCCCCTGGCGTAGGTCTCAGG - Intronic
1179725675 21:43340166-43340188 GTGCTCCAGGTGGAGAATTCCGG - Intergenic
1181016432 22:20071758-20071780 GTCCCCCAGGTGAAGATGTCCGG - Intergenic
1181486324 22:23234030-23234052 GAGCCCCAGGCCGAGTCCTCTGG + Intronic
1181988207 22:26816474-26816496 GGGCCCCAGGAGGAGATCCCAGG - Intergenic
1183093927 22:35541139-35541161 GAGCCCCAGGCGGGGACCCCCGG + Exonic
1183323705 22:37180332-37180354 GTGCCCCGGGGGGTGATCTCTGG - Exonic
1184368511 22:44068030-44068052 GTGCTCCAGGCGGGGCTCTGGGG - Intronic
950032815 3:9863311-9863333 GTGCCCCAGGGGCAAACCTCTGG - Intergenic
950416061 3:12869543-12869565 GTGCCCCAGGGGCAAACCTCTGG - Intronic
958580125 3:96007586-96007608 GTGCCCCAGGAGGAGGGCTGGGG - Intergenic
963262626 3:143208125-143208147 GTGCCCCAGTCTCAGATTTCTGG - Intergenic
966830738 3:184006165-184006187 TTACCTCAGCCGGAGATCTCTGG + Intronic
968977208 4:3828184-3828206 GTGTCCCAGGCTCAGCTCTCTGG + Intergenic
969090374 4:4689611-4689633 GTGCTCCAGGGGGAGGCCTCTGG - Intergenic
970755148 4:19416928-19416950 ATGCCCCAGGTTGAGTTCTCTGG + Intergenic
973954468 4:56049278-56049300 GAGCGCCAGGCGGGGACCTCAGG + Intergenic
975683120 4:76896346-76896368 GTCCCTCAGGAGGAGCTCTCTGG - Exonic
985297619 4:188452398-188452420 GTGGCCCAGGTGGAGAGCTGGGG + Intergenic
985923124 5:2995177-2995199 GTGCCCCAGTTAGAGTTCTCTGG + Intergenic
986228634 5:5840991-5841013 GTACCCCAGAAGGAGATCTGAGG - Intergenic
986235969 5:5910471-5910493 GTGCTCCAGGAGTAGTTCTCAGG + Intergenic
986564686 5:9100348-9100370 GTGCCCCAGGTGGATGTGTCTGG - Intronic
991669384 5:69032545-69032567 GTGTCTTAGGCTGAGATCTCTGG - Intergenic
995652399 5:114384619-114384641 GTGCTCCAGGGAAAGATCTCTGG + Intronic
996157127 5:120115551-120115573 GTGCCCCAGGGAGAGCTCTGTGG - Intergenic
998135851 5:139674136-139674158 CAGCCCCAGGCGGAGAGCACAGG - Intronic
998765292 5:145479603-145479625 GTGCACCAGGCGCAGTGCTCAGG - Intronic
1002539330 5:179895577-179895599 GTGGCCCAGGGGGATGTCTCTGG - Intronic
1003197198 6:3925722-3925744 GTGCCCCAGCCGGGGACCCCGGG - Intergenic
1003318625 6:5033425-5033447 GTGCCCCAGCCGGGGACCCCGGG + Intergenic
1005859007 6:29887485-29887507 GGGCCCCAGGCGTGGCTCTCAGG + Intergenic
1006040563 6:31250432-31250454 GTTACCCAGGAGGAGTTCTCAGG + Intergenic
1010732296 6:79404205-79404227 GTGACCGAGGCAGAGAACTCTGG + Intergenic
1013351492 6:109309998-109310020 AAGCCCCAGGTGGACATCTCAGG + Intergenic
1016703261 6:147077646-147077668 CTGCCCCAGGGAGACATCTCAGG + Intergenic
1019103629 6:169651036-169651058 GTGCTCCAGGCAGAAATCCCAGG - Intronic
1019103656 6:169651148-169651170 GTGCTCCAGGCAGAAATCCCAGG - Intronic
1019828383 7:3301749-3301771 GTGTCCCCGCCGGAGGTCTCGGG - Exonic
1020119452 7:5495020-5495042 GTGCCCCAGGCGGCGTGCTGTGG - Intronic
1029610159 7:101622494-101622516 GTGCCCCAGGAGGGGATCAGTGG + Intronic
1030156020 7:106456530-106456552 GTGACCCAAGCAGTGATCTCTGG - Intergenic
1031982592 7:128137158-128137180 GTGCCCCAGGCCGATGTCCCAGG - Intergenic
1033332776 7:140429888-140429910 CACCCCCAGGAGGAGATCTCAGG + Intergenic
1033789572 7:144775444-144775466 GTGCCCCAGATGCAGATCTTTGG + Intronic
1039441347 8:37597574-37597596 GAATCCCAGGCGAAGATCTCAGG + Intergenic
1042358442 8:67855070-67855092 GAGCCTCAGCAGGAGATCTCTGG + Intergenic
1046525386 8:115376259-115376281 GTCCTCCAGGAGGAGATGTCTGG + Intergenic
1048043487 8:130752465-130752487 GTGCCCCAGTCTCAGATCACTGG + Intergenic
1048963588 8:139599342-139599364 TTGGCCCAGGCAGAGATCTTGGG - Intergenic
1049535460 8:143178580-143178602 ACGCCCCAGGCGGAAATTTCGGG - Intergenic
1050339468 9:4621300-4621322 GTACCCCTGGGGGAGATCCCTGG - Intronic
1053382883 9:37663259-37663281 CTGCCCCAGGCTGAGAGATCTGG + Intronic
1055780984 9:79821452-79821474 GTGCCCCAGGCAGAAAGATCAGG - Intergenic
1056683361 9:88739481-88739503 GTGCCCCAGGCAATGATATCTGG - Intergenic
1061990899 9:134158073-134158095 GACCCCCAGGCGCAGATCTGGGG - Exonic
1192434233 X:71132948-71132970 GTGCACCAGGTACAGATCTCTGG + Exonic
1199170913 X:144733508-144733530 GTGCCCTAGGAGGAGCTCTGTGG + Intergenic
1200155880 X:153974706-153974728 GTGCCCCATGCTGAGATGGCAGG + Intronic